Transcript: Mouse NM_026301.2

Mus musculus ring finger protein 125 (Rnf125), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Rnf125 (67664)
Length:
1334
CDS:
249..671

Additional Resources:

NCBI RefSeq record:
NM_026301.2
NBCI Gene record:
Rnf125 (67664)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106403 GCACATAAGGACCTGTGAGAA pLKO.1 314 CDS 100% 4.950 6.930 N Rnf125 n/a
2 TRCN0000106400 GCCCTTACATTCTTGAGTCTA pLKO.1 835 3UTR 100% 4.950 6.930 N Rnf125 n/a
3 TRCN0000106404 AGTACCTTCAATGGCAGTTTA pLKO.1 516 CDS 100% 13.200 10.560 N Rnf125 n/a
4 TRCN0000106402 GCAAGATGTGTATGTCCATTT pLKO.1 381 CDS 100% 10.800 7.560 N Rnf125 n/a
5 TRCN0000106401 GCCATTCACGACCTGATGAAA pLKO.1 490 CDS 100% 5.625 3.938 N Rnf125 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.