Transcript: Mouse NM_026308.2

Mus musculus ribonuclease P 21 subunit (Rpp21), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rpp21 (67676)
Length:
500
CDS:
8..460

Additional Resources:

NCBI RefSeq record:
NM_026308.2
NBCI Gene record:
Rpp21 (67676)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125685 GCAGCGCCAGAGACGCCGAAA pLKO.1 235 CDS 100% 0.000 0.000 N Rpp21 n/a
2 TRCN0000288131 GCAGCGCCAGAGACGCCGAAA pLKO_005 235 CDS 100% 0.000 0.000 N Rpp21 n/a
3 TRCN0000125684 GAGATTCCTCAACGACCCTAA pLKO.1 304 CDS 100% 4.050 2.835 N Rpp21 n/a
4 TRCN0000288056 GAGATTCCTCAACGACCCTAA pLKO_005 304 CDS 100% 4.050 2.835 N Rpp21 n/a
5 TRCN0000307545 TACAGACCTGTCTGACATGCC pLKO_005 273 CDS 100% 2.160 1.512 N Rpp21 n/a
6 TRCN0000125687 CCTCTGTGAAGAGGACGCTCT pLKO.1 171 CDS 100% 0.072 0.050 N Rpp21 n/a
7 TRCN0000288132 CCTCTGTGAAGAGGACGCTCT pLKO_005 171 CDS 100% 0.072 0.050 N Rpp21 n/a
8 TRCN0000125688 AGCTTCCTGTACCAGGCTGCA pLKO.1 50 CDS 100% 0.720 0.432 N Rpp21 n/a
9 TRCN0000288057 AGCTTCCTGTACCAGGCTGCA pLKO_005 50 CDS 100% 0.720 0.432 N Rpp21 n/a
10 TRCN0000125686 CGGCCTGAAGCCCAGCTGGAA pLKO.1 344 CDS 100% 0.000 0.000 N Rpp21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.