Transcript: Mouse NM_026316.2

Mus musculus aldehyde dehydrogenase 3 family, member B1 (Aldh3b1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Aldh3b1 (67689)
Length:
1915
CDS:
23..1429

Additional Resources:

NCBI RefSeq record:
NM_026316.2
NBCI Gene record:
Aldh3b1 (67689)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041774 GCCCTGGAATTATCCCATTAA pLKO.1 358 CDS 100% 13.200 18.480 N Aldh3b1 n/a
2 TRCN0000437026 GATAATCGGCACAGGTCATAC pLKO_005 1689 3UTR 100% 10.800 15.120 N Aldh3b1 n/a
3 TRCN0000429867 CACCCTCTCGTGGATAGTGTT pLKO_005 1655 3UTR 100% 4.950 6.930 N Aldh3b1 n/a
4 TRCN0000429593 GGCCTGGTTCCGCTACTTTAA pLKO_005 718 CDS 100% 13.200 9.240 N Aldh3b1 n/a
5 TRCN0000418456 GAACACAAGTTCGACTACATC pLKO_005 554 CDS 100% 4.950 3.465 N Aldh3b1 n/a
6 TRCN0000041777 GAATGCTTATGTAGGCAAGAT pLKO.1 586 CDS 100% 4.950 3.465 N Aldh3b1 n/a
7 TRCN0000041773 GACCATAGAATCTTCGAGAAA pLKO.1 1613 3UTR 100% 4.950 3.465 N Aldh3b1 n/a
8 TRCN0000431554 AGATAGGCTGAGGGTAGGAAG pLKO_005 1575 3UTR 100% 4.050 2.835 N Aldh3b1 n/a
9 TRCN0000041775 CCAGGTTATCAAACAGGTGTT pLKO.1 1135 CDS 100% 4.050 2.835 N Aldh3b1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026316.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.