Transcript: Mouse NM_026335.2

Mus musculus late cornified envelope 1H (Lce1h), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Lce1h (67718)
Length:
706
CDS:
78..500

Additional Resources:

NCBI RefSeq record:
NM_026335.2
NBCI Gene record:
Lce1h (67718)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249142 TGGGTGAGGAAGACTTCAAAC pLKO_005 503 3UTR 100% 10.800 6.480 N Lce1h n/a
2 TRCN0000249140 TGTAGCAGTGGTGGCAACAGT pLKO_005 381 CDS 100% 3.000 1.800 N Lce1h n/a
3 TRCN0000201888 CCCTCTGAGTTGCTGAAATCT pLKO.1 603 3UTR 100% 5.625 2.813 Y Lce1g n/a
4 TRCN0000249141 AGGAGGAGCACATGCTCAGAA pLKO_005 533 3UTR 100% 4.950 2.475 Y Lce1h n/a
5 TRCN0000247073 GTGTCTTCCTGCTGTAGCTTG pLKO_005 195 CDS 100% 4.050 2.025 Y Lce1i n/a
6 TRCN0000416200 TCCTGCTGTAGCTTGGGTTCT pLKO_005 201 CDS 100% 4.050 2.025 Y Lce1e n/a
7 TRCN0000249139 AGATCTCTTCGTCGCCATCGT pLKO_005 345 CDS 100% 2.640 1.320 Y Lce1h n/a
8 TRCN0000249138 TGCTGTAGCTTGGGTTCTGGT pLKO_005 204 CDS 100% 2.640 1.320 Y Lce1h n/a
9 TRCN0000247882 ACAGATCTCTTCGTCGCCATC pLKO_005 343 CDS 100% 2.250 1.125 Y Lce1d n/a
10 TRCN0000249512 TGTGGCAGTAGCCAGCAGTCT pLKO_005 465 CDS 100% 0.880 0.440 Y Lce1b n/a
11 TRCN0000257210 GGCTGCTGTGGCTCCAGCTCT pLKO_005 225 CDS 100% 0.000 0.000 Y LCE1A n/a
12 TRCN0000247075 GAGCACATGCTCAGAAGATTC pLKO_005 538 3UTR 100% 10.800 5.400 Y Lce1i n/a
13 TRCN0000181189 CTAAATGCCCTCCCAAGTGTA pLKO.1 169 CDS 100% 4.950 2.475 Y LCE5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026335.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.