Transcript: Mouse NM_026337.1

Mus musculus SAFB-like, transcription modulator (Sltm), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Sltm (66660)
Length:
3569
CDS:
143..3184

Additional Resources:

NCBI RefSeq record:
NM_026337.1
NBCI Gene record:
Sltm (66660)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000279123 CAAGACACAAGCATCTATTAA pLKO_005 1567 CDS 100% 15.000 21.000 N Sltm n/a
2 TRCN0000191656 GAGAGAACATTTAGTTCGTTT pLKO.1 1930 CDS 100% 4.950 6.930 N Sltm n/a
3 TRCN0000191206 CGCATTAGAATAATTCGTGAA pLKO.1 2024 CDS 100% 4.050 5.670 N Sltm n/a
4 TRCN0000279124 GGAACGGTTTGTTGGTCAAAG pLKO_005 2458 CDS 100% 10.800 8.640 N Sltm n/a
5 TRCN0000202243 GCTACCATGACACAAGACGAA pLKO.1 3009 CDS 100% 2.640 2.112 N Sltm n/a
6 TRCN0000279192 GCTACCATGACACAAGACGAA pLKO_005 3009 CDS 100% 2.640 2.112 N Sltm n/a
7 TRCN0000279125 TGCTGTGGCTTCAAGATAATT pLKO_005 3196 3UTR 100% 15.000 10.500 N Sltm n/a
8 TRCN0000190432 CCACCACCAAGAAATGAACTT pLKO.1 2573 CDS 100% 4.950 3.465 N Sltm n/a
9 TRCN0000201857 GCATGATAACCCAACACTCAA pLKO.1 3054 CDS 100% 4.950 3.465 N Sltm n/a
10 TRCN0000134364 GCCTAGAAATTGAAAGGCAAA pLKO.1 2082 CDS 100% 4.050 2.835 N SLTM n/a
11 TRCN0000279193 GTGAAGAGAAGAAGCGGATAA pLKO_005 1713 CDS 100% 10.800 6.480 N Sltm n/a
12 TRCN0000135690 CGCATTCGTATTGAACAGGAA pLKO.1 2147 CDS 100% 2.640 3.696 N SLTM n/a
13 TRCN0000352804 CGCATTCGTATTGAACAGGAA pLKO_005 2147 CDS 100% 2.640 3.696 N SLTM n/a
14 TRCN0000137418 GCAGGCATGATAACCCAACAT pLKO.1 3050 CDS 100% 4.950 3.960 N SLTM n/a
15 TRCN0000343135 GCAGGCATGATAACCCAACAT pLKO_005 3050 CDS 100% 4.950 3.960 N SLTM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026337.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.