Transcript: Mouse NM_026347.3

Mus musculus isoamyl acetate-hydrolyzing esterase 1 homolog (Iah1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Iah1 (67732)
Length:
941
CDS:
41..790

Additional Resources:

NCBI RefSeq record:
NM_026347.3
NBCI Gene record:
Iah1 (67732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177676 CCTGAAGGGTTGCAAATTAAA pLKO.1 478 CDS 100% 15.000 10.500 N Iah1 n/a
2 TRCN0000278699 CCTGAAGGGTTGCAAATTAAA pLKO_005 478 CDS 100% 15.000 10.500 N Iah1 n/a
3 TRCN0000176812 GAATATGCAAATGCGTGTTTA pLKO.1 521 CDS 100% 13.200 9.240 N Iah1 n/a
4 TRCN0000278633 GAATATGCAAATGCGTGTTTA pLKO_005 521 CDS 100% 13.200 9.240 N Iah1 n/a
5 TRCN0000198232 GATGTTCTGAATCGTGGATTT pLKO.1 182 CDS 100% 10.800 7.560 N Iah1 n/a
6 TRCN0000265423 GATGTTCTGAATCGTGGATTT pLKO_005 182 CDS 100% 10.800 7.560 N IAH1 n/a
7 TRCN0000297583 GATGTTCTGAATCGTGGATTT pLKO_005 182 CDS 100% 10.800 7.560 N Iah1 n/a
8 TRCN0000178665 CTCTTCACTCAAAGATGAGAA pLKO.1 310 CDS 100% 4.950 3.465 N Iah1 n/a
9 TRCN0000278630 CTCTTCACTCAAAGATGAGAA pLKO_005 310 CDS 100% 4.950 3.465 N Iah1 n/a
10 TRCN0000198319 GCATTTATCACCAATGGGAAA pLKO.1 637 CDS 100% 4.050 2.835 N Iah1 n/a
11 TRCN0000278698 GCATTTATCACCAATGGGAAA pLKO_005 637 CDS 100% 4.050 2.835 N Iah1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026347.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.