Transcript: Mouse NM_026359.3

Mus musculus RIKEN cDNA 4930578I06 gene (4930578I06Rik), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
4930578I06Rik (67750)
Length:
1066
CDS:
34..930

Additional Resources:

NCBI RefSeq record:
NM_026359.3
NBCI Gene record:
4930578I06Rik (67750)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026359.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192793 GCATGCTCAATATAGACCAGA pLKO.1 978 3UTR 100% 2.640 3.696 N 4930578I06Rik n/a
2 TRCN0000202305 GCTTCTACAGTACGAGATCCA pLKO.1 747 CDS 100% 2.640 3.696 N 4930578I06Rik n/a
3 TRCN0000200930 CCATCCATATCCAGATTGCAT pLKO.1 716 CDS 100% 3.000 2.400 N 4930578I06Rik n/a
4 TRCN0000215422 GATTACCAGAAGCAGTTTAAT pLKO.1 322 CDS 100% 15.000 10.500 N 4930578I06Rik n/a
5 TRCN0000216583 GACTATTCCCATAACACTTTC pLKO.1 367 CDS 100% 10.800 7.560 N 4930578I06Rik n/a
6 TRCN0000191875 GAAAGCCAAAGCTAAGAAGTA pLKO.1 909 CDS 100% 4.950 3.465 N 4930578I06Rik n/a
7 TRCN0000192912 GAAGCCATCCATATCCAGATT pLKO.1 712 CDS 100% 4.950 3.465 N 4930578I06Rik n/a
8 TRCN0000202475 GTGAAGCCATCCATATCCAGA pLKO.1 710 CDS 100% 2.640 1.848 N 4930578I06Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026359.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.