Transcript: Mouse NM_026368.2

Mus musculus caspase activity and apoptosis inhibitor 1 (Caap1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Caap1 (67770)
Length:
2109
CDS:
93..1163

Additional Resources:

NCBI RefSeq record:
NM_026368.2
NBCI Gene record:
Caap1 (67770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201000 CGAACTTGCTTTAAGAGCTTT pLKO.1 1694 3UTR 100% 4.950 6.930 N Caap1 n/a
2 TRCN0000167680 GATAGTGATGTACTCAGTATA pLKO.1 783 CDS 100% 13.200 10.560 N CAAP1 n/a
3 TRCN0000216389 GATAGTGATGTACTCAGTATA pLKO.1 783 CDS 100% 13.200 10.560 N Caap1 n/a
4 TRCN0000192067 CTTCTGTATCATAGGAGAGAA pLKO.1 482 CDS 100% 4.950 3.960 N Caap1 n/a
5 TRCN0000298102 CTTCTGTATCATAGGAGAGAA pLKO_005 482 CDS 100% 4.950 3.960 N Caap1 n/a
6 TRCN0000192969 GCGAAACCTAATGAACTGTTT pLKO.1 1654 3UTR 100% 4.950 3.960 N Caap1 n/a
7 TRCN0000293048 GCGAAACCTAATGAACTGTTT pLKO_005 1654 3UTR 100% 4.950 3.960 N Caap1 n/a
8 TRCN0000189995 GCAGATGCTTATGACAGCGAT pLKO.1 807 CDS 100% 2.640 2.112 N Caap1 n/a
9 TRCN0000263493 TAGTGATGTACTCAGTATAAA pLKO_005 785 CDS 100% 15.000 10.500 N CAAP1 n/a
10 TRCN0000193014 GATGCTTATGACAGCGATATA pLKO.1 810 CDS 100% 13.200 9.240 N Caap1 n/a
11 TRCN0000298100 GATGCTTATGACAGCGATATA pLKO_005 810 CDS 100% 13.200 9.240 N Caap1 n/a
12 TRCN0000215488 GGAGCTTCTAGAACTTGAAAT pLKO.1 1085 CDS 100% 13.200 9.240 N Caap1 n/a
13 TRCN0000215905 CAATTAAGGCTCTCATGAAAG pLKO.1 1117 CDS 100% 10.800 7.560 N Caap1 n/a
14 TRCN0000189719 GCAGCAGGAAACCAAGTATCT pLKO.1 329 CDS 100% 4.950 3.465 N Caap1 n/a
15 TRCN0000191990 GCTTTAAGAAAGATTGACCAA pLKO.1 1481 3UTR 100% 2.640 1.848 N Caap1 n/a
16 TRCN0000292984 GCTTTAAGAAAGATTGACCAA pLKO_005 1481 3UTR 100% 2.640 1.848 N Caap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026368.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.