Transcript: Mouse NM_026429.4

Mus musculus trophoblast specific protein beta (Tpbpb), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Tpbpb (116913)
Length:
736
CDS:
85..450

Additional Resources:

NCBI RefSeq record:
NM_026429.4
NBCI Gene record:
Tpbpb (116913)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026429.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192289 CCCAATATGTGAACTGCCTTA pLKO.1 520 3UTR 100% 4.050 2.835 N Tpbpb n/a
2 TRCN0000192340 CCAATGTTGGAAGAGGAGAAA pLKO.1 346 CDS 100% 4.950 2.970 N Tpbpb n/a
3 TRCN0000201992 CCTGCACTCAAGTCCCTTAAA pLKO.1 628 3UTR 100% 13.200 6.600 Y Tpbpb n/a
4 TRCN0000202081 CCAGTTGTTGATGACCCTGAA pLKO.1 373 CDS 100% 4.050 2.025 Y Tpbpb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026429.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.