Transcript: Mouse NM_026438.4

Mus musculus pyrophosphatase (inorganic) 1 (Ppa1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ppa1 (67895)
Length:
1292
CDS:
108..977

Additional Resources:

NCBI RefSeq record:
NM_026438.4
NBCI Gene record:
Ppa1 (67895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026438.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114175 GCGAATCTGTTCCCTTATAAA pLKO.1 351 CDS 100% 15.000 21.000 N Ppa1 n/a
2 TRCN0000309313 GCGAATCTGTTCCCTTATAAA pLKO_005 351 CDS 100% 15.000 21.000 N Ppa1 n/a
3 TRCN0000114172 CCACGATTATTGGAAAGCATT pLKO.1 776 CDS 100% 4.950 6.930 N Ppa1 n/a
4 TRCN0000114173 CGCAGCCAATTATAAAGATAT pLKO.1 602 CDS 100% 13.200 10.560 N Ppa1 n/a
5 TRCN0000311294 GATTGGTTTAGAAGGTATAAG pLKO_005 669 CDS 100% 13.200 9.240 N Ppa1 n/a
6 TRCN0000305322 CAACGACCCAATCGATGTTTG pLKO_005 455 CDS 100% 10.800 7.560 N Ppa1 n/a
7 TRCN0000311296 CTCTGGAACACGAGCTGTTAC pLKO_005 986 3UTR 100% 10.800 7.560 N Ppa1 n/a
8 TRCN0000114174 CAGTACATTTCTCCATTTCAT pLKO.1 186 CDS 100% 5.625 3.938 N Ppa1 n/a
9 TRCN0000309312 CAGTACATTTCTCCATTTCAT pLKO_005 186 CDS 100% 5.625 3.938 N Ppa1 n/a
10 TRCN0000114171 CCTGGAAGCATTAGATGCAAA pLKO.1 1023 3UTR 100% 4.950 3.465 N Ppa1 n/a
11 TRCN0000050862 GATTGCTACAAAGGACCCTTT pLKO.1 284 CDS 100% 4.050 2.835 N PPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026438.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.