Transcript: Mouse NM_026454.3

Mus musculus ubiquitin-conjugating enzyme E2F (putative) (Ube2f), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ube2f (67921)
Length:
1363
CDS:
136..693

Additional Resources:

NCBI RefSeq record:
NM_026454.3
NBCI Gene record:
Ube2f (67921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098574 GAACATTCAATTGATGGCACT pLKO.1 499 CDS 100% 2.160 1.296 N Ube2f n/a
2 TRCN0000287773 GAACATTCAATTGATGGCACT pLKO_005 499 CDS 100% 2.160 1.296 N Ube2f n/a
3 TRCN0000098573 GCAGAACTTGAAGCTAATTTA pLKO.1 259 CDS 100% 15.000 7.500 Y Ube2f n/a
4 TRCN0000287847 GCAGAACTTGAAGCTAATTTA pLKO_005 259 CDS 100% 15.000 7.500 Y Ube2f n/a
5 TRCN0000098570 GCAATAAGAAACCCGCTATAA pLKO.1 1085 3UTR 100% 13.200 6.600 Y Ube2f n/a
6 TRCN0000287772 GCAATAAGAAACCCGCTATAA pLKO_005 1085 3UTR 100% 13.200 6.600 Y Ube2f n/a
7 TRCN0000295289 TCGGGACAAAGTGGATGAATA pLKO_005 651 CDS 100% 13.200 6.600 Y Ube2f n/a
8 TRCN0000416997 TGATCCAAACAAGCTTCATTG pLKO_005 306 CDS 100% 10.800 5.400 Y UBE2F n/a
9 TRCN0000098572 CCAAGGTGAAATGCTTGACTA pLKO.1 422 CDS 100% 4.950 2.475 Y Ube2f n/a
10 TRCN0000098571 GAGGGTTTCTGTGAGAGACAA pLKO.1 219 CDS 100% 4.950 2.475 Y Ube2f n/a
11 TRCN0000287774 GAGGGTTTCTGTGAGAGACAA pLKO_005 219 CDS 100% 4.950 2.475 Y Ube2f n/a
12 TRCN0000034112 CAGAACATCATTTGCGGGACA pLKO.1 620 CDS 100% 2.160 1.080 Y UBE2F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026454.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.