Transcript: Mouse NM_026460.3

Mus musculus serine (or cysteine) peptidase inhibitor, clade I, member 2 (Serpini2), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Serpini2 (67931)
Length:
1424
CDS:
56..1273

Additional Resources:

NCBI RefSeq record:
NM_026460.3
NBCI Gene record:
Serpini2 (67931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026460.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080209 CCTGACATTCAAACAACGAAA pLKO.1 1229 CDS 100% 4.950 3.960 N Serpini2 n/a
2 TRCN0000080208 GCGAGCACAATATGGTTATTT pLKO.1 715 CDS 100% 15.000 10.500 N Serpini2 n/a
3 TRCN0000080211 CCTCTACCTTCAAGAAGGATT pLKO.1 385 CDS 100% 4.950 3.465 N Serpini2 n/a
4 TRCN0000080210 CGAGCATCGAAGAAGTGGAAA pLKO.1 825 CDS 100% 4.950 3.465 N Serpini2 n/a
5 TRCN0000080212 CCCTCTACCTTCAAGAAGGAT pLKO.1 384 CDS 100% 3.000 2.100 N Serpini2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026460.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.