Transcript: Mouse NM_026486.3

Mus musculus tectonic family member 2 (Tctn2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Tctn2 (67978)
Length:
2735
CDS:
127..2229

Additional Resources:

NCBI RefSeq record:
NM_026486.3
NBCI Gene record:
Tctn2 (67978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121436 CCACAACGCATCAGAGAACAT pLKO.1 576 CDS 100% 4.950 3.960 N Tctn2 n/a
2 TRCN0000435149 CTCATCCAGGTGGAGATTTAT pLKO_005 538 CDS 100% 15.000 10.500 N Tctn2 n/a
3 TRCN0000436793 GCACGCTGGAAGTGACCATAA pLKO_005 395 CDS 100% 10.800 7.560 N Tctn2 n/a
4 TRCN0000121435 CCCTACGAGATTCCAGATCAA pLKO.1 2004 CDS 100% 4.950 3.465 N Tctn2 n/a
5 TRCN0000121433 GCCAGTTACAAGCAAGGAGAT pLKO.1 952 CDS 100% 4.050 2.835 N Tctn2 n/a
6 TRCN0000121434 CCCAGAAACGTGAATGTGGAA pLKO.1 1246 CDS 100% 2.640 1.848 N Tctn2 n/a
7 TRCN0000121432 CCTCTCTGAAACCTGTCAGTT pLKO.1 2283 3UTR 100% 4.950 2.970 N Tctn2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026486.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.