Transcript: Mouse NM_026495.3

Mus musculus nucleus accumbens associated 2, BEN and BTB (POZ) domain containing (Nacc2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nacc2 (67991)
Length:
6370
CDS:
184..1944

Additional Resources:

NCBI RefSeq record:
NM_026495.3
NBCI Gene record:
Nacc2 (67991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026495.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217642 GCAGTATGGCCAGATGTATAT pLKO.1 1020 CDS 100% 13.200 18.480 N Nacc2 n/a
2 TRCN0000241080 GCAGTATGGCCAGATGTATAT pLKO_005 1020 CDS 100% 13.200 18.480 N Nacc2 n/a
3 TRCN0000229266 CCTATGCAGGGACCTTGTAAG pLKO_005 1925 CDS 100% 10.800 15.120 N NACC2 n/a
4 TRCN0000241082 GGATCCAGCCATGAGTCTTAT pLKO_005 4846 3UTR 100% 13.200 9.240 N Nacc2 n/a
5 TRCN0000241084 AGAGCGAGATGAACGTGATTG pLKO_005 1466 CDS 100% 10.800 7.560 N Nacc2 n/a
6 TRCN0000241083 ATGTGTCCATCGTGGTCAAAG pLKO_005 275 CDS 100% 10.800 7.560 N Nacc2 n/a
7 TRCN0000241081 TGTTTGAGCAGCGCATCTATG pLKO_005 1646 CDS 100% 10.800 7.560 N Nacc2 n/a
8 TRCN0000191763 GAAACTGTACTGTCAGAACTT pLKO.1 1428 CDS 100% 4.950 3.465 N Nacc2 n/a
9 TRCN0000181213 CCACCTTCTTTGACAGGAACA pLKO.1 1319 CDS 100% 4.050 2.835 N NACC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026495.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.