Transcript: Mouse NM_026498.2

Mus musculus mitochondrial ribosomal protein S11 (Mrps11), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Mrps11 (67994)
Length:
1043
CDS:
229..804

Additional Resources:

NCBI RefSeq record:
NM_026498.2
NBCI Gene record:
Mrps11 (67994)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099079 GCTAAGAATATCCACACCGGA pLKO.1 313 CDS 100% 0.660 0.924 N Mrps11 n/a
2 TRCN0000311344 AGTGGGCAGGGATGAAGTTTG pLKO_005 440 CDS 100% 10.800 7.560 N Mrps11 n/a
3 TRCN0000099076 ACACATTAAAGCAACCTACAA pLKO.1 477 CDS 100% 4.950 3.465 N Mrps11 n/a
4 TRCN0000099078 CATTAAAGCAACCTACAACAA pLKO.1 480 CDS 100% 4.950 3.465 N Mrps11 n/a
5 TRCN0000332012 CATTAAAGCAACCTACAACAA pLKO_005 480 CDS 100% 4.950 3.465 N Mrps11 n/a
6 TRCN0000099075 CCACATCAGAGTCGTAGTGAA pLKO.1 654 CDS 100% 4.950 3.465 N Mrps11 n/a
7 TRCN0000332076 CCACATCAGAGTCGTAGTGAA pLKO_005 654 CDS 100% 4.950 3.465 N Mrps11 n/a
8 TRCN0000311346 CTTGACTCCTGTGGATCCTAC pLKO_005 841 3UTR 100% 4.050 2.835 N Mrps11 n/a
9 TRCN0000099077 CCGAGATTAGAAGACTCAGCT pLKO.1 337 CDS 100% 2.640 1.848 N Mrps11 n/a
10 TRCN0000332014 CCGAGATTAGAAGACTCAGCT pLKO_005 337 CDS 100% 2.640 1.848 N Mrps11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.