Transcript: Mouse NM_026535.2

Mus musculus serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 (Serpina12), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Serpina12 (68054)
Length:
3690
CDS:
199..1440

Additional Resources:

NCBI RefSeq record:
NM_026535.2
NBCI Gene record:
Serpina12 (68054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429262 TATGACCCTAGTGGGTAATAA pLKO_005 1423 CDS 100% 15.000 21.000 N Serpina12 n/a
2 TRCN0000080220 GCTCGACACAACATGGAATTT pLKO.1 343 CDS 100% 13.200 18.480 N Serpina12 n/a
3 TRCN0000080221 CGTGATGATTCTCACAAATTA pLKO.1 798 CDS 100% 15.000 12.000 N Serpina12 n/a
4 TRCN0000080222 CCGCATCTCGTCTACTTACAA pLKO.1 1131 CDS 100% 5.625 4.500 N Serpina12 n/a
5 TRCN0000080219 GCTCACTAACTTCCAGGACTT pLKO.1 687 CDS 100% 4.050 3.240 N Serpina12 n/a
6 TRCN0000413929 ACTTAGGCAATGCTTTATTTA pLKO_005 596 CDS 100% 15.000 10.500 N Serpina12 n/a
7 TRCN0000417432 AGTGTCTGTGATGTGATAAAC pLKO_005 1694 3UTR 100% 13.200 9.240 N Serpina12 n/a
8 TRCN0000425885 CCTTCCTCATGATGATCTATG pLKO_005 1364 CDS 100% 10.800 7.560 N Serpina12 n/a
9 TRCN0000080218 GCCAGATTTGTTCATTTCTTT pLKO.1 2095 3UTR 100% 5.625 3.938 N Serpina12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026535.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.