Transcript: Mouse NM_026572.3

Mus musculus glycine cleavage system protein H (aminomethyl carrier) (Gcsh), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gcsh (68133)
Length:
1337
CDS:
24..536

Additional Resources:

NCBI RefSeq record:
NM_026572.3
NBCI Gene record:
Gcsh (68133)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101602 GACCCTTCAGAGATGGATGAA pLKO.1 465 CDS 100% 4.950 3.465 N Gcsh n/a
2 TRCN0000101601 CGAAGATGGTTGGCTGATCAA pLKO.1 431 CDS 100% 4.950 2.970 N Gcsh n/a
3 TRCN0000352043 CGAAGATGGTTGGCTGATCAA pLKO_005 431 CDS 100% 4.950 2.970 N Gcsh n/a
4 TRCN0000101600 CGGTCTACACAACAAGTTCTA pLKO.1 886 3UTR 100% 4.950 2.970 N Gcsh n/a
5 TRCN0000352045 CGGTCTACACAACAAGTTCTA pLKO_005 886 3UTR 100% 4.950 2.970 N Gcsh n/a
6 TRCN0000101604 CCCTTCAGAGATGGATGAATT pLKO.1 467 CDS 100% 0.000 0.000 N Gcsh n/a
7 TRCN0000352044 CCCTTCAGAGATGGATGAATT pLKO_005 467 CDS 100% 0.000 0.000 N Gcsh n/a
8 TRCN0000083394 GTGCGTAAATTCACAGAGAAA pLKO.1 162 CDS 100% 4.950 2.475 Y GCSH n/a
9 TRCN0000101603 TCTGCCTGAAGTTGGGACAAA pLKO.1 272 CDS 100% 4.950 2.475 Y Gcsh n/a
10 TRCN0000352122 TCTGCCTGAAGTTGGGACAAA pLKO_005 272 CDS 100% 4.950 2.475 Y Gcsh n/a
11 TRCN0000083393 CGTTGGGAGATGTTGTTTATT pLKO.1 247 CDS 100% 15.000 10.500 N GCSH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026572.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.