Transcript: Mouse NM_026648.4

Mus musculus dynein, axonemal assembly factor 1 (Dnaaf1), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Dnaaf1 (68270)
Length:
2821
CDS:
128..2032

Additional Resources:

NCBI RefSeq record:
NM_026648.4
NBCI Gene record:
Dnaaf1 (68270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026648.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088070 CCTGAACGACACCCTGTATTT pLKO.1 430 CDS 100% 13.200 18.480 N Dnaaf1 n/a
2 TRCN0000088071 GACACCCTGTATTTGCACTTT pLKO.1 437 CDS 100% 4.950 3.960 N Dnaaf1 n/a
3 TRCN0000088068 CCACAAGAACATAAACACTTT pLKO.1 2191 3UTR 100% 4.950 3.465 N Dnaaf1 n/a
4 TRCN0000088072 CCTGTTGCACAAGATCGAGAA pLKO.1 592 CDS 100% 4.050 2.835 N Dnaaf1 n/a
5 TRCN0000088069 GCCAATAGCAACAACGGACTT pLKO.1 1729 CDS 100% 4.050 2.835 N Dnaaf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026648.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.