Transcript: Mouse NM_026667.3

Mus musculus family with sequence similarity 114, member A1 (Fam114a1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Fam114a1 (68303)
Length:
2949
CDS:
79..1788

Additional Resources:

NCBI RefSeq record:
NM_026667.3
NBCI Gene record:
Fam114a1 (68303)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174459 CCTCCTTATCGAAGAAGTTTA pLKO.1 1574 CDS 100% 13.200 18.480 N Fam114a1 n/a
2 TRCN0000193979 GCCACATCTCTTCACTACATA pLKO.1 1800 3UTR 100% 5.625 7.875 N Fam114a1 n/a
3 TRCN0000215339 CAGATTGCAGCTAGTTCAATA pLKO.1 1775 CDS 100% 13.200 10.560 N Fam114a1 n/a
4 TRCN0000216642 CCTGGTCAACCAGACTATATT pLKO.1 2037 3UTR 100% 15.000 10.500 N Fam114a1 n/a
5 TRCN0000193436 GCAATGAAGTAACCTCCTTAT pLKO.1 1562 CDS 100% 10.800 7.560 N Fam114a1 n/a
6 TRCN0000194212 GCTGCATTGAACAGCTACATA pLKO.1 1451 CDS 100% 5.625 3.938 N Fam114a1 n/a
7 TRCN0000175119 CAAACTCAATAAGGCCATGAA pLKO.1 1230 CDS 100% 4.950 3.465 N Fam114a1 n/a
8 TRCN0000137767 GCCCTGGAAATTCTGTCCAAT pLKO.1 991 CDS 100% 4.950 3.465 N FAM114A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026667.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.