Transcript: Mouse NM_026729.1

Mus musculus mitochondrial ribosomal protein L58 (Mrpl58), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Mrpl58 (68572)
Length:
734
CDS:
10..543

Additional Resources:

NCBI RefSeq record:
NM_026729.1
NBCI Gene record:
Mrpl58 (68572)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192824 GACTAAACTCTGCCCTAAAGA pLKO.1 497 CDS 100% 5.625 7.875 N Mrpl58 n/a
2 TRCN0000320270 GACTAAACTCTGCCCTAAAGA pLKO_005 497 CDS 100% 5.625 7.875 N Mrpl58 n/a
3 TRCN0000191389 CGGTTAAGCATATCTTACTGT pLKO.1 148 CDS 100% 3.000 4.200 N Mrpl58 n/a
4 TRCN0000320268 CGGTTAAGCATATCTTACTGT pLKO_005 148 CDS 100% 3.000 4.200 N Mrpl58 n/a
5 TRCN0000192508 GCTGAAGTAAGGTTTCACTTG pLKO.1 217 CDS 100% 4.050 3.240 N Mrpl58 n/a
6 TRCN0000320343 GCTGAAGTAAGGTTTCACTTG pLKO_005 217 CDS 100% 4.050 3.240 N Mrpl58 n/a
7 TRCN0000201410 CCTCTGGATCGGTTAAGCATA pLKO.1 139 CDS 100% 4.950 3.465 N Mrpl58 n/a
8 TRCN0000201555 CTGGCAGAATGCCTACAGAAA pLKO.1 361 CDS 100% 4.950 3.465 N Mrpl58 n/a
9 TRCN0000159769 GCAGAATGTGAACAAAGTGAA pLKO.1 189 CDS 100% 4.950 3.465 N MRPL58 n/a
10 TRCN0000192369 CTTCAGAGACTCAGGATTGAA pLKO.1 445 CDS 100% 5.625 3.375 N Mrpl58 n/a
11 TRCN0000320269 CTTCAGAGACTCAGGATTGAA pLKO_005 445 CDS 100% 5.625 3.375 N Mrpl58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.