Transcript: Mouse NM_026742.4

Mus musculus NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4 (Ndufaf4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ndufaf4 (68493)
Length:
3632
CDS:
85..606

Additional Resources:

NCBI RefSeq record:
NM_026742.4
NBCI Gene record:
Ndufaf4 (68493)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026742.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012008 TGAGGGCCATAACGTTTGAAA pLKO.1 696 3UTR 100% 5.625 7.875 N Ndufaf4 n/a
2 TRCN0000012009 CCGGAGTCAGTATCCAGAAAT pLKO.1 213 CDS 100% 13.200 10.560 N Ndufaf4 n/a
3 TRCN0000280199 CCGGAGTCAGTATCCAGAAAT pLKO_005 213 CDS 100% 13.200 10.560 N Ndufaf4 n/a
4 TRCN0000280148 GGGAAACACAGTGACTATATT pLKO_005 938 3UTR 100% 15.000 10.500 N Ndufaf4 n/a
5 TRCN0000012010 CCGATAGGAAATCACTTTGAT pLKO.1 367 CDS 100% 5.625 3.938 N Ndufaf4 n/a
6 TRCN0000280147 CCGATAGGAAATCACTTTGAT pLKO_005 367 CDS 100% 5.625 3.938 N Ndufaf4 n/a
7 TRCN0000012011 GCTCAAGAGTACTATTTAGAA pLKO.1 493 CDS 100% 5.625 3.938 N Ndufaf4 n/a
8 TRCN0000280200 GCTCAAGAGTACTATTTAGAA pLKO_005 493 CDS 100% 5.625 3.938 N Ndufaf4 n/a
9 TRCN0000012012 CACGACAAGAACCAAAGGAAT pLKO.1 338 CDS 100% 4.950 3.465 N Ndufaf4 n/a
10 TRCN0000280145 CACGACAAGAACCAAAGGAAT pLKO_005 338 CDS 100% 4.950 3.465 N Ndufaf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026742.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.