Transcript: Mouse NM_026770.1

Mus musculus cell growth regulator with EF hand domain 1 (Cgref1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Cgref1 (68567)
Length:
1350
CDS:
6..983

Additional Resources:

NCBI RefSeq record:
NM_026770.1
NBCI Gene record:
Cgref1 (68567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219467 AGCGTTGATGCTGCCACTATT pLKO.1 161 CDS 100% 13.200 18.480 N Cgref1 n/a
2 TRCN0000346692 AGCGTTGATGCTGCCACTATT pLKO_005 161 CDS 100% 13.200 18.480 N Cgref1 n/a
3 TRCN0000219471 ACGGTGGTGCAAGCTAGTAAC pLKO.1 1079 3UTR 100% 10.800 15.120 N Cgref1 n/a
4 TRCN0000346694 ACGGTGGTGCAAGCTAGTAAC pLKO_005 1079 3UTR 100% 10.800 15.120 N Cgref1 n/a
5 TRCN0000219469 AGAGCCTAAACACTCCAAATG pLKO.1 919 CDS 100% 10.800 8.640 N Cgref1 n/a
6 TRCN0000346693 AGAGCCTAAACACTCCAAATG pLKO_005 919 CDS 100% 10.800 8.640 N Cgref1 n/a
7 TRCN0000219470 TGAGGCTCATAGCATCCAATT pLKO.1 944 CDS 100% 10.800 8.640 N Cgref1 n/a
8 TRCN0000219468 TCCGACATCTGCAGAATTATC pLKO.1 289 CDS 100% 13.200 9.240 N Cgref1 n/a
9 TRCN0000346637 TCCGACATCTGCAGAATTATC pLKO_005 289 CDS 100% 13.200 9.240 N Cgref1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026770.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.