Transcript: Mouse NM_026785.2

Mus musculus ubiquitin-conjugating enzyme E2C (Ube2c), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ube2c (68612)
Length:
931
CDS:
52..591

Additional Resources:

NCBI RefSeq record:
NM_026785.2
NBCI Gene record:
Ube2c (68612)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241132 ATACCTGCAAGAAACCTATTC pLKO_005 543 CDS 100% 10.800 15.120 N Ube2c n/a
2 TRCN0000241130 TCATGACATCTGGTGACAAAG pLKO_005 176 CDS 100% 10.800 15.120 N Ube2c n/a
3 TRCN0000241128 GATAAGTGGTCTGCACTATAT pLKO_005 409 CDS 100% 13.200 10.560 N Ube2c n/a
4 TRCN0000241131 TCTGTCCTTTCTCCTTGATTT pLKO_005 643 3UTR 100% 13.200 9.240 N Ube2c n/a
5 TRCN0000241129 TATGAAGACCTGAGGTACAAA pLKO_005 271 CDS 100% 5.625 3.938 N Ube2c n/a
6 TRCN0000087953 GCAGGAACTGATGATCCTCAT pLKO.1 159 CDS 100% 4.050 2.430 N LOC435923 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.