Transcript: Mouse NM_026880.2

Mus musculus PTEN induced putative kinase 1 (Pink1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pink1 (68943)
Length:
2367
CDS:
78..1820

Additional Resources:

NCBI RefSeq record:
NM_026880.2
NBCI Gene record:
Pink1 (68943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322198 GAACTTTGCTTGTCGTCAATA pLKO_005 2180 3UTR 100% 13.200 18.480 N Pink1 n/a
2 TRCN0000007100 GTTCCTCGTTATGAAGAACTA pLKO.1 1016 CDS 100% 4.950 6.930 N PINK1 n/a
3 TRCN0000222218 GAGGATTATCTGATAGGGCAA pLKO.1 537 CDS 100% 2.160 1.728 N Pink1 n/a
4 TRCN0000222216 CCTGGCTGACTATCCTGATAT pLKO.1 947 CDS 100% 13.200 9.240 N Pink1 n/a
5 TRCN0000322262 CCTGGCTGACTATCCTGATAT pLKO_005 947 CDS 100% 13.200 9.240 N Pink1 n/a
6 TRCN0000222214 GCGGTAATTGACTACAGCAAA pLKO.1 1353 CDS 100% 4.950 3.465 N Pink1 n/a
7 TRCN0000322263 GCGGTAATTGACTACAGCAAA pLKO_005 1353 CDS 100% 4.950 3.465 N Pink1 n/a
8 TRCN0000222215 GCTGCAAATGTGCTGCACTTA pLKO.1 1581 CDS 100% 4.950 3.465 N Pink1 n/a
9 TRCN0000350677 GCTGCAAATGTGCTGCACTTA pLKO_005 1581 CDS 100% 4.950 3.465 N Pink1 n/a
10 TRCN0000222217 GCCTATGAAATCTTTGGGCTT pLKO.1 1401 CDS 100% 2.160 1.512 N Pink1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026880.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.