Transcript: Mouse NM_026894.1

Mus musculus TAM41 mitochondrial translocator assembly and maintenance homolog (Tamm41), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tamm41 (68971)
Length:
1183
CDS:
91..1104

Additional Resources:

NCBI RefSeq record:
NM_026894.1
NBCI Gene record:
Tamm41 (68971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184728 CAAGGCCAACTGGAGATAGAT pLKO.1 784 CDS 100% 5.625 7.875 N Tamm41 n/a
2 TRCN0000293090 CAAGGCCAACTGGAGATAGAT pLKO_005 784 CDS 100% 5.625 7.875 N Tamm41 n/a
3 TRCN0000183339 GAGAATCCCATGTTAGACTTA pLKO.1 223 CDS 100% 4.950 3.960 N Tamm41 n/a
4 TRCN0000293089 GAGAATCCCATGTTAGACTTA pLKO_005 223 CDS 100% 4.950 3.960 N Tamm41 n/a
5 TRCN0000183025 CTCCTCCATCCAGAATAATTA pLKO.1 342 CDS 100% 15.000 10.500 N Tamm41 n/a
6 TRCN0000293147 CTCCTCCATCCAGAATAATTA pLKO_005 342 CDS 100% 15.000 10.500 N Tamm41 n/a
7 TRCN0000217616 GAATGAGAACATGGCTCTTAG pLKO.1 519 CDS 100% 10.800 7.560 N Tamm41 n/a
8 TRCN0000196063 GCGACTAGCGATCTCATCAAT pLKO.1 957 CDS 100% 5.625 3.938 N Tamm41 n/a
9 TRCN0000183879 CCTCATGCTACCTGAAAGCTT pLKO.1 585 CDS 100% 3.000 2.100 N Tamm41 n/a
10 TRCN0000293091 CCTCATGCTACCTGAAAGCTT pLKO_005 585 CDS 100% 3.000 2.100 N Tamm41 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.