Transcript: Mouse NM_026960.4

Mus musculus gasdermin D (Gsdmd), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gsdmd (69146)
Length:
1776
CDS:
148..1611

Additional Resources:

NCBI RefSeq record:
NM_026960.4
NBCI Gene record:
Gsdmd (69146)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026960.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182401 GATGTCGTCGATGGGAACATT pLKO.1 400 CDS 100% 5.625 7.875 N Gsdmd n/a
2 TRCN0000181291 CCAACTGCTTATTGGCTCTAA pLKO.1 807 CDS 100% 4.950 6.930 N Gsdmd n/a
3 TRCN0000182752 CCTATTGTCAAGTCTAGGCCA pLKO.1 1578 CDS 100% 0.660 0.924 N Gsdmd n/a
4 TRCN0000198744 CTTCTCGTCTCAGATGAGAAA pLKO.1 838 CDS 100% 0.495 0.396 N Gsdmd n/a
5 TRCN0000219619 GATTGATGAGGAGGAATTAAT pLKO.1 978 CDS 100% 15.000 10.500 N Gsdmd n/a
6 TRCN0000181625 GCCTCCATGAATGTGTGTATA pLKO.1 496 CDS 100% 13.200 9.240 N Gsdmd n/a
7 TRCN0000219620 CCTAAGGCTGCAGGTAGAATC pLKO.1 1494 CDS 100% 10.800 7.560 N Gsdmd n/a
8 TRCN0000181898 GCTTTATGCTTGAAGGGTGAA pLKO.1 715 CDS 100% 4.050 2.835 N Gsdmd n/a
9 TRCN0000198776 CCTGTTCCTATTGTCAAGTCT pLKO.1 1572 CDS 100% 3.000 2.100 N Gsdmd n/a
10 TRCN0000182711 CCTGTCAATCAAGGACATCCT pLKO.1 324 CDS 100% 2.640 1.848 N Gsdmd n/a
11 TRCN0000181454 CTGGTGAACATCGGAAAGATT pLKO.1 1090 CDS 100% 5.625 3.375 N Gsdmd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026960.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.