Transcript: Mouse NM_026988.2

Mus musculus parathymosin (Ptms), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptms (69202)
Length:
1155
CDS:
343..648

Additional Resources:

NCBI RefSeq record:
NM_026988.2
NBCI Gene record:
Ptms (69202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363870 GCGGAAGAGAACTGCTGAAGA pLKO_005 573 CDS 100% 4.950 6.930 N Ptms n/a
2 TRCN0000346745 AGTGCCAAGGACCTGAAAGAA pLKO_005 379 CDS 100% 5.625 3.938 N Ptms n/a
3 TRCN0000191312 CTAGCATTCTTGTTCTTCTTT pLKO.1 890 3UTR 100% 5.625 3.938 N Ptms n/a
4 TRCN0000190119 CCGGAAAGAACGGAAGAAAGA pLKO.1 429 CDS 100% 4.950 3.465 N Ptms n/a
5 TRCN0000346743 CCGGAAAGAACGGAAGAAAGA pLKO_005 429 CDS 100% 4.950 3.465 N Ptms n/a
6 TRCN0000191081 CCTAGCATTCTTGTTCTTCTT pLKO.1 889 3UTR 100% 4.950 3.465 N Ptms n/a
7 TRCN0000346744 CCTAGCATTCTTGTTCTTCTT pLKO_005 889 3UTR 100% 4.950 3.465 N Ptms n/a
8 TRCN0000363869 CCAAGAGGCAGAAGACAGAAA pLKO_005 611 CDS 100% 4.950 2.970 N Ptms n/a
9 TRCN0000201020 CTTGTTCTTCTTTCCTGCCTT pLKO.1 898 3UTR 100% 2.640 1.584 N Ptms n/a
10 TRCN0000192586 GAAGAAGAAACTGCAGAGGAT pLKO.1 487 CDS 100% 2.640 1.584 N Ptms n/a
11 TRCN0000202382 GCTGAGGAAGAGGAAGAAGAA pLKO.1 475 CDS 100% 4.950 2.475 Y Ptms n/a
12 TRCN0000144651 GAAGAAGATGAGGAAGAAGAA pLKO.1 532 CDS 100% 4.950 2.475 Y PTMS n/a
13 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 542 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026988.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.