Transcript: Mouse NM_027011.2

Mus musculus keratin 5 (Krt5), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Krt5 (110308)
Length:
2190
CDS:
82..1824

Additional Resources:

NCBI RefSeq record:
NM_027011.2
NBCI Gene record:
Krt5 (110308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089844 CCGTTGTTTGAACAGTACATT pLKO.1 712 CDS 100% 5.625 4.500 N Krt5 n/a
2 TRCN0000089845 GCACGAGATCTCTGAGATGAA pLKO.1 1212 CDS 100% 4.950 3.465 N Krt5 n/a
3 TRCN0000089843 GCTCAGTTCTACATTTGTGTT pLKO.1 2008 3UTR 100% 4.950 3.465 N Krt5 n/a
4 TRCN0000089846 TCCGTTGTTTGAACAGTACAT pLKO.1 711 CDS 100% 4.950 3.465 N Krt5 n/a
5 TRCN0000089847 GCCAACCTCCAGAACGCCATT pLKO.1 1285 CDS 100% 1.350 0.945 N Krt5 n/a
6 TRCN0000425222 AGGAGTTGGACCAGTCAACAT pLKO_005 1515 CDS 100% 4.950 2.970 N KRT5 n/a
7 TRCN0000084030 CAACAAGTTTGCCTCCTTCAT pLKO.1 591 CDS 100% 4.950 2.475 Y KRT6A n/a
8 TRCN0000062387 GCAGATCAAGACCCTCAACAA pLKO.1 573 CDS 100% 4.950 2.475 Y KRT8 n/a
9 TRCN0000082891 CAACAACAAGTTTGCCTCCTT pLKO.1 588 CDS 100% 2.640 1.320 Y KRT6B n/a
10 TRCN0000116954 CCTCCTTCATCGACAAGGTAT pLKO.1 602 CDS 100% 4.950 2.475 Y KRT8P11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027011.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.