Transcript: Mouse NM_027083.1

Mus musculus lysozyme-like 6 (Lyzl6), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lyzl6 (69444)
Length:
914
CDS:
189..635

Additional Resources:

NCBI RefSeq record:
NM_027083.1
NBCI Gene record:
Lyzl6 (69444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099845 CCTTGGACATTCTTCACTATT pLKO.1 682 3UTR 100% 13.200 18.480 N Lyzl6 n/a
2 TRCN0000099847 CGCTGTAGTTTGGCCAAGATT pLKO.1 258 CDS 100% 5.625 7.875 N Lyzl6 n/a
3 TRCN0000099848 CGTTGATGGTAGCTTCGACTA pLKO.1 383 CDS 100% 4.050 5.670 N Lyzl6 n/a
4 TRCN0000099846 CCCAACCTCATTTCAACCATT pLKO.1 498 CDS 100% 4.950 3.465 N Lyzl6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027083.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.