Transcript: Mouse NM_027109.3

Mus musculus deoxyribonuclease 1-like 1 (Dnase1l1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Mus musculus (mouse)
Gene:
Dnase1l1 (69537)
Length:
1515
CDS:
273..1163

Additional Resources:

NCBI RefSeq record:
NM_027109.3
NBCI Gene record:
Dnase1l1 (69537)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108730 GCTCAGATCATACCTAAGATT pLKO.1 1360 3UTR 100% 5.625 7.875 N Dnase1l1 n/a
2 TRCN0000303005 GCTCAGATCATACCTAAGATT pLKO_005 1360 3UTR 100% 5.625 7.875 N Dnase1l1 n/a
3 TRCN0000108731 GCCAGTACTAACTGTACCTAT pLKO.1 924 CDS 100% 4.950 3.960 N Dnase1l1 n/a
4 TRCN0000311232 TCCGCATCAGTGACCATTATC pLKO_005 1045 CDS 100% 13.200 9.240 N Dnase1l1 n/a
5 TRCN0000108732 CAGGAGTTACAGCTTCCTAAA pLKO.1 503 CDS 100% 10.800 7.560 N Dnase1l1 n/a
6 TRCN0000303079 CAGGAGTTACAGCTTCCTAAA pLKO_005 503 CDS 100% 10.800 7.560 N Dnase1l1 n/a
7 TRCN0000108733 CATTTCACTCTCCCTAGCAAA pLKO.1 657 CDS 100% 4.950 3.465 N Dnase1l1 n/a
8 TRCN0000108734 GAGTCAGTGATGGATACCTTA pLKO.1 384 CDS 100% 4.950 3.465 N Dnase1l1 n/a
9 TRCN0000303080 GAGTCAGTGATGGATACCTTA pLKO_005 384 CDS 100% 4.950 3.465 N Dnase1l1 n/a
10 TRCN0000305032 GACAAGACACAGGTCCTAAAT pLKO_005 582 CDS 100% 13.200 7.920 N Dnase1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.