Transcript: Mouse NM_027115.2

Mus musculus mitogen-activated protein kinase 1 interacting protein 1 (Mapk1ip1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-01-20
Taxon:
Mus musculus (mouse)
Gene:
Mapk1ip1 (69546)
Length:
1420
CDS:
539..1330

Additional Resources:

NCBI RefSeq record:
NM_027115.2
NBCI Gene record:
Mapk1ip1 (69546)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191699 CATATCTATTTCCAGAGTCAT pLKO.1 816 CDS 100% 4.950 6.930 N Mapk1ip1 n/a
2 TRCN0000192011 CAAGGTCATATGTTTCAACAA pLKO.1 666 CDS 100% 0.000 0.000 N Mapk1ip1 n/a
3 TRCN0000200520 CTTTAACTCACAAAGCTGAAA pLKO.1 1200 CDS 100% 4.950 3.465 N Mapk1ip1 n/a
4 TRCN0000189997 GCACCTGAAGCTAGACAACAA pLKO.1 1117 CDS 100% 4.950 2.970 N Mapk1ip1 n/a
5 TRCN0000165138 GATCCATGTCTTCTGGACCTT pLKO.1 759 CDS 100% 2.640 1.584 N MAPK1IP1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027115.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.