Transcript: Mouse NM_027120.2

Mus musculus nicotinamide riboside kinase 2 (Nmrk2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Nmrk2 (69564)
Length:
1840
CDS:
62..649

Additional Resources:

NCBI RefSeq record:
NM_027120.2
NBCI Gene record:
Nmrk2 (69564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024987 CCAGAAGTATAGACGGGAGAT pLKO.1 520 CDS 100% 4.050 5.670 N Nmrk2 n/a
2 TRCN0000360729 AGGAGAAGAAGCCGTACTTAC pLKO_005 449 CDS 100% 10.800 8.640 N Nmrk2 n/a
3 TRCN0000024986 CGTGATCCATCAGGATGACTT pLKO.1 151 CDS 100% 4.950 3.960 N Nmrk2 n/a
4 TRCN0000360730 ATCAAGTTCTGGAGGATATTC pLKO_005 603 CDS 100% 13.200 9.240 N Nmrk2 n/a
5 TRCN0000359396 GGCCCATGTACCAGAAGTATA pLKO_005 510 CDS 100% 13.200 9.240 N NMRK2 n/a
6 TRCN0000360731 GAAACAACATCTACCCTAATG pLKO_005 956 3UTR 100% 10.800 7.560 N Nmrk2 n/a
7 TRCN0000024984 GAGGAGAAGAAGCCGTACTTA pLKO.1 448 CDS 100% 5.625 3.938 N Nmrk2 n/a
8 TRCN0000161138 CCATCAGGATGACTTCTTCAA pLKO.1 157 CDS 100% 4.950 3.465 N NMRK2 n/a
9 TRCN0000024988 CCTGACCAACAGCCTCCTCAA pLKO.1 112 CDS 100% 1.350 0.945 N Nmrk2 n/a
10 TRCN0000024985 CCATCAAGTTCTGGAGGATAT pLKO.1 601 CDS 100% 10.800 6.480 N Nmrk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027120.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.