Transcript: Mouse NM_027172.3

Mus musculus solute carrier protein family 52, member 3 (Slc52a3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc52a3 (69698)
Length:
2698
CDS:
211..1593

Additional Resources:

NCBI RefSeq record:
NM_027172.3
NBCI Gene record:
Slc52a3 (69698)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126735 CCACTGGTTAATGTACTGAAA pLKO.1 1528 CDS 100% 4.950 6.930 N Slc52a3 n/a
2 TRCN0000126737 GTACTATCTTACCACCTTCTT pLKO.1 615 CDS 100% 4.950 3.960 N Slc52a3 n/a
3 TRCN0000126738 CGTACTATCTTACCACCTTCT pLKO.1 614 CDS 100% 4.050 3.240 N Slc52a3 n/a
4 TRCN0000126734 GCAGACTTTGTTCTCTGTCTT pLKO.1 1864 3UTR 100% 4.950 3.465 N Slc52a3 n/a
5 TRCN0000126736 GCCTAACAGGTCGCTGTTATT pLKO.1 1248 CDS 100% 1.320 0.924 N Slc52a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027172.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.