Transcript: Mouse NM_027263.2

Mus musculus apoptosis-inducing, TAF9-like domain 1 (Apitd1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Apitd1 (69928)
Length:
930
CDS:
78..506

Additional Resources:

NCBI RefSeq record:
NM_027263.2
NBCI Gene record:
Apitd1 (69928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191787 GCCAAAGACCTTGAAATGTTT pLKO.1 258 CDS 100% 5.625 7.875 N Apitd1 n/a
2 TRCN0000190102 GCTCTTAGCCAGGCGAAATAA pLKO.1 323 CDS 100% 15.000 12.000 N Apitd1 n/a
3 TRCN0000200819 GCTTAGTCCTTCACTGTTTAT pLKO.1 773 3UTR 100% 13.200 9.240 N Apitd1 n/a
4 TRCN0000191486 GCGAAATAATTCACTGCTAAA pLKO.1 335 CDS 100% 10.800 7.560 N Apitd1 n/a
5 TRCN0000262598 TTTGCCAAAGACCTTGAAATG pLKO_005 255 CDS 100% 10.800 7.560 N CENPS n/a
6 TRCN0000202254 GCATAGGAAAGGCTTGCACTT pLKO.1 683 3UTR 100% 4.050 2.835 N Apitd1 n/a
7 TRCN0000190168 CCCAGCTTAACCTGAAAGGAA pLKO.1 385 CDS 100% 3.000 2.100 N Apitd1 n/a
8 TRCN0000202199 CACGCTGAACAAACAGGTGAA pLKO.1 176 CDS 100% 4.050 2.430 N Apitd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.