Transcript: Mouse NM_027275.3

Mus musculus pentatricopeptide repeat domain 3 (Ptcd3), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ptcd3 (69956)
Length:
2601
CDS:
23..2080

Additional Resources:

NCBI RefSeq record:
NM_027275.3
NBCI Gene record:
Ptcd3 (69956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340549 ATCCTCTACGTAAGGTATATT pLKO_005 1374 CDS 100% 15.000 21.000 N Ptcd3 n/a
2 TRCN0000340480 CAAGAGATTTAAGCGCTATAA pLKO_005 1161 CDS 100% 13.200 18.480 N Ptcd3 n/a
3 TRCN0000340479 TTTCATGGAGATGGGTTATTA pLKO_005 2428 3UTR 100% 15.000 12.000 N Ptcd3 n/a
4 TRCN0000340548 TTGCAACATACCATCATATTA pLKO_005 1125 CDS 100% 15.000 10.500 N Ptcd3 n/a
5 TRCN0000351065 ATATAGCTGAGCCTCATATAC pLKO_005 417 CDS 100% 13.200 9.240 N Ptcd3 n/a
6 TRCN0000193768 CCATCCCTCATCATCTATGAT pLKO.1 1187 CDS 100% 5.625 3.938 N Ptcd3 n/a
7 TRCN0000176327 CCAAAGGTTGAAGGATCAGAT pLKO.1 155 CDS 100% 4.950 3.465 N Ptcd3 n/a
8 TRCN0000176409 CCCAAAGAGTAGTGATGGATT pLKO.1 1959 CDS 100% 4.950 3.465 N Ptcd3 n/a
9 TRCN0000173317 GCATCCACAGTAAACAGGGAT pLKO.1 248 CDS 100% 2.640 1.848 N Ptcd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027275.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.