Transcript: Mouse NM_027342.1

Mus musculus family with sequence similarity 162, member A (Fam162a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Fam162a (70186)
Length:
635
CDS:
13..480

Additional Resources:

NCBI RefSeq record:
NM_027342.1
NBCI Gene record:
Fam162a (70186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124505 CGTGGCAGGATGCATCTATAT pLKO.1 348 CDS 100% 13.200 18.480 N Fam162a n/a
2 TRCN0000124504 CGTCTCTAAGGTTTACCAGAA pLKO.1 83 CDS 100% 4.050 5.670 N Fam162a n/a
3 TRCN0000124506 CCCAGAGACAATCTCATTTGA pLKO.1 264 CDS 100% 5.625 3.938 N Fam162a n/a
4 TRCN0000124508 GATCCCAGAGACAATCTCATT pLKO.1 261 CDS 100% 4.950 3.465 N Fam162a n/a
5 TRCN0000124507 CCTCGTCTCTAAGGTTTACCA pLKO.1 80 CDS 100% 3.000 2.100 N Fam162a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027342.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.