Transcript: Mouse NM_027346.1

Mus musculus translational activator of mitochondrially encoded cytochrome c oxidase I (Taco1), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Taco1 (70207)
Length:
1351
CDS:
142..1026

Additional Resources:

NCBI RefSeq record:
NM_027346.1
NBCI Gene record:
Taco1 (70207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201833 GCGCTTAACAACTATGAGGAT pLKO.1 976 CDS 100% 2.640 3.696 N Taco1 n/a
2 TRCN0000191313 CAAGGGCATTTATTTGCTATA pLKO.1 525 CDS 100% 10.800 7.560 N Taco1 n/a
3 TRCN0000189516 CGTTATCAAACAGTGGTCCCA pLKO.1 587 CDS 100% 0.660 0.462 N Taco1 n/a
4 TRCN0000190146 GCAGCAATCTCAGAGACTGAA pLKO.1 1079 3UTR 100% 4.950 2.970 N Taco1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027346.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.