Transcript: Mouse NM_027395.2

Mus musculus brain abundant, membrane attached signal protein 1 (Basp1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Basp1 (70350)
Length:
1855
CDS:
223..903

Additional Resources:

NCBI RefSeq record:
NM_027395.2
NBCI Gene record:
Basp1 (70350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148376 CTACAATGTGAACGACGAGAA pLKO.1 255 CDS 100% 4.050 5.670 N BASP1 n/a
2 TRCN0000250263 CTACAATGTGAACGACGAGAA pLKO_005 255 CDS 100% 4.050 5.670 N Basp1 n/a
3 TRCN0000281321 CTACAATGTGAACGACGAGAA pLKO_005 255 CDS 100% 4.050 5.670 N BASP1 n/a
4 TRCN0000147603 GCACCTGTAGTTCTGTTTATT pLKO.1 1605 3UTR 100% 15.000 10.500 N BASP1 n/a
5 TRCN0000281254 GCACCTGTAGTTCTGTTTATT pLKO_005 1605 3UTR 100% 15.000 10.500 N BASP1 n/a
6 TRCN0000250262 GCCAAGGACAAAGACAAGAAG pLKO_005 277 CDS 100% 4.950 3.465 N Basp1 n/a
7 TRCN0000250266 GGCTTCAGACTCTAAACCTAG pLKO_005 717 CDS 100% 4.050 2.835 N Basp1 n/a
8 TRCN0000190229 CGGCTTCAGACTCTAAACCTA pLKO.1 716 CDS 100% 3.000 2.100 N Basp1 n/a
9 TRCN0000250264 TCAAGGAGAGCACGGAGGAGA pLKO_005 374 CDS 100% 0.880 0.616 N Basp1 n/a
10 TRCN0000250265 ACGAGAAGGCCAAGGACAAAG pLKO_005 269 CDS 100% 10.800 6.480 N Basp1 n/a
11 TRCN0000202255 GAAGGCCAAGGACAAAGACAA pLKO.1 273 CDS 100% 4.950 2.970 N Basp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027395.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.