Transcript: Mouse NM_027399.3

Mus musculus six transmembrane epithelial antigen of the prostate 1 (Steap1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Steap1 (70358)
Length:
1216
CDS:
103..1122

Additional Resources:

NCBI RefSeq record:
NM_027399.3
NBCI Gene record:
Steap1 (70358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125738 CCATCATATCATCCCTGACTT pLKO.1 338 CDS 100% 4.950 3.960 N Steap1 n/a
2 TRCN0000288052 CCATCATATCATCCCTGACTT pLKO_005 338 CDS 100% 4.950 3.960 N Steap1 n/a
3 TRCN0000125736 CCTGGAGAGAATTTCACTATA pLKO.1 839 CDS 100% 13.200 9.240 N Steap1 n/a
4 TRCN0000295393 CTCTTGGCACTGGTCTATTTG pLKO_005 475 CDS 100% 13.200 9.240 N Steap1 n/a
5 TRCN0000125737 ACCTGGAGAGAATTTCACTAT pLKO.1 838 CDS 100% 4.950 3.465 N Steap1 n/a
6 TRCN0000288130 ACCTGGAGAGAATTTCACTAT pLKO_005 838 CDS 100% 4.950 3.465 N Steap1 n/a
7 TRCN0000125735 CCTGGTTATTAACAAAGTCTT pLKO.1 435 CDS 100% 4.950 3.465 N Steap1 n/a
8 TRCN0000288053 CCTGGTTATTAACAAAGTCTT pLKO_005 435 CDS 100% 4.950 3.465 N Steap1 n/a
9 TRCN0000125734 GCCTGGAATAAATGGGTAGAT pLKO.1 919 CDS 100% 4.950 3.465 N Steap1 n/a
10 TRCN0000365784 TGGAGAGAATTTCACTATATT pLKO_005 841 CDS 100% 15.000 9.000 N STEAP1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027399.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.