Transcript: Mouse NM_027436.3

Mus musculus mitochondrial intermediate peptidase (Mipep), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Mipep (70478)
Length:
2423
CDS:
123..2258

Additional Resources:

NCBI RefSeq record:
NM_027436.3
NBCI Gene record:
Mipep (70478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031160 GCCGAACTATTTATGTTTGAT pLKO.1 663 CDS 100% 5.625 7.875 N Mipep n/a
2 TRCN0000031161 GCCGATCAGTTGAAATGTTTA pLKO.1 942 CDS 100% 13.200 10.560 N Mipep n/a
3 TRCN0000031163 CCTACTGACTTTGCTGAAGTT pLKO.1 1671 CDS 100% 4.950 3.960 N Mipep n/a
4 TRCN0000031159 CCCAGTTTATACTGCCCGTTT pLKO.1 1236 CDS 100% 4.050 3.240 N Mipep n/a
5 TRCN0000031162 CCAGGGATTTCCCTACATTAT pLKO.1 1549 CDS 100% 13.200 9.240 N Mipep n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027436.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.