Transcript: Mouse NM_027442.5

Mus musculus D-aspartate oxidase (Ddo), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ddo (70503)
Length:
3002
CDS:
85..1110

Additional Resources:

NCBI RefSeq record:
NM_027442.5
NBCI Gene record:
Ddo (70503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027442.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246356 ATGCGACCTAGGAGCTAATTT pLKO_005 2152 3UTR 100% 15.000 21.000 N Ddo n/a
2 TRCN0000246354 CCACACAGAAGCGATGGTTTA pLKO_005 269 CDS 100% 10.800 15.120 N Ddo n/a
3 TRCN0000246357 GTAGCGGCTGGGATGCTTATT pLKO_005 220 CDS 100% 13.200 10.560 N Ddo n/a
4 TRCN0000246358 TCCACAGAGCCTACGACATAA pLKO_005 878 CDS 100% 13.200 10.560 N Ddo n/a
5 TRCN0000202244 GCGATGGTTTAGAGAGACCTT pLKO.1 279 CDS 100% 2.640 2.112 N Ddo n/a
6 TRCN0000246355 TGTCTACTGCAGCATGCATTT pLKO_005 131 CDS 100% 10.800 7.560 N Ddo n/a
7 TRCN0000189898 GCATGCATTTCCCAACTGGTT pLKO.1 142 CDS 100% 2.640 1.848 N Ddo n/a
8 TRCN0000217357 GTATCTGGTTGGCAGATATTC pLKO.1 358 CDS 100% 1.320 0.924 N Ddo n/a
9 TRCN0000202149 CTGGTGATGGAGTGTATCCAT pLKO.1 1054 CDS 100% 0.300 0.210 N Ddo n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2679 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027442.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.