Transcript: Mouse NM_027448.2

Mus musculus Leber congenital amaurosis 5 (human) (Lca5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lca5 (75782)
Length:
4235
CDS:
362..2476

Additional Resources:

NCBI RefSeq record:
NM_027448.2
NBCI Gene record:
Lca5 (75782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414656 GGCTAAATATGGCACAATTAA pLKO_005 2605 3UTR 100% 15.000 21.000 N Lca5 n/a
2 TRCN0000432827 CAAATAGTGCCGTACCATAAA pLKO_005 2627 3UTR 100% 13.200 18.480 N Lca5 n/a
3 TRCN0000120963 CCGAGTAAAGACAGTCTTGAT pLKO.1 2135 CDS 100% 4.950 3.960 N Lca5 n/a
4 TRCN0000120962 CCGGAGTGATATGTTTGGAAA pLKO.1 3307 3UTR 100% 4.950 3.465 N Lca5 n/a
5 TRCN0000120966 CACAACTTATACACCGCCATA pLKO.1 843 CDS 100% 4.050 2.835 N Lca5 n/a
6 TRCN0000120964 CCGTTAGGAAAGTAAGTCCTA pLKO.1 561 CDS 100% 0.264 0.185 N Lca5 n/a
7 TRCN0000120965 GCAGAAAGACTAAAGACAGAA pLKO.1 1733 CDS 100% 4.950 2.970 N Lca5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.