Transcript: Mouse NM_027513.1

Mus musculus nucleoporin 205 (Nup205), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Nup205 (70699)
Length:
6244
CDS:
17..6043

Additional Resources:

NCBI RefSeq record:
NM_027513.1
NBCI Gene record:
Nup205 (70699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346452 TGGCGCCATCTGGAGTATTAT pLKO_005 5732 CDS 100% 15.000 21.000 N Nup205 n/a
2 TRCN0000346379 CAAGTGAACCAGCACGATATA pLKO_005 5864 CDS 100% 13.200 10.560 N Nup205 n/a
3 TRCN0000346378 GACCTGTTGCCTCCAACTATT pLKO_005 1523 CDS 100% 13.200 10.560 N Nup205 n/a
4 TRCN0000346453 CTGTGCTACCAGGTGATATAT pLKO_005 3200 CDS 100% 15.000 10.500 N Nup205 n/a
5 TRCN0000346449 ACTGACTCTCTTCCGTGGAAG pLKO_005 6046 3UTR 100% 4.050 2.835 N Nup205 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027513.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.