Transcript: Mouse NM_027518.2

Mus musculus G protein-coupled receptor 137C (Gpr137c), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Gpr137c (70713)
Length:
2444
CDS:
277..1548

Additional Resources:

NCBI RefSeq record:
NM_027518.2
NBCI Gene record:
Gpr137c (70713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245749 TCGTGGGCTCTGTAGTCATTC pLKO_005 1001 CDS 100% 10.800 7.560 N GPR137C n/a
2 TRCN0000126286 GCCTACAGTTCTCCACGCTCT pLKO.1 656 CDS 100% 0.720 0.504 N Gpr137c n/a
3 TRCN0000126287 CCGCGCTCTTCGCCTTTGCCT pLKO.1 431 CDS 100% 0.000 0.000 N Gpr137c n/a
4 TRCN0000126288 GCCACCCTCTCGCCTGCACTT pLKO.1 600 CDS 100% 0.000 0.000 N Gpr137c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027518.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.