Transcript: Mouse NM_027551.2

Mus musculus kelch-like 30 (Klhl30), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Klhl30 (70788)
Length:
3020
CDS:
137..1882

Additional Resources:

NCBI RefSeq record:
NM_027551.2
NBCI Gene record:
Klhl30 (70788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173229 CAAATGGACACAGCCCTTCAT pLKO.1 1837 CDS 100% 4.950 3.465 N Klhl30 n/a
2 TRCN0000193885 CAATCTCAACACAGCCTACAT pLKO.1 1628 CDS 100% 4.950 3.465 N Klhl30 n/a
3 TRCN0000194346 CCTGTATCTCATCGGTGACAA pLKO.1 1555 CDS 100% 4.950 3.465 N Klhl30 n/a
4 TRCN0000174989 GACAACACTAAGAAAGTCTAT pLKO.1 1571 CDS 100% 4.950 3.465 N Klhl30 n/a
5 TRCN0000173295 GAGTGTCATCGCTTCACCTTT pLKO.1 1486 CDS 100% 4.950 3.465 N Klhl30 n/a
6 TRCN0000175885 GCTAAGACAGTTCCTCATGTT pLKO.1 2601 3UTR 100% 4.950 3.465 N Klhl30 n/a
7 TRCN0000193204 CCTGCCAATCATGATATGATT pLKO.1 2866 3UTR 100% 0.563 0.394 N Klhl30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027551.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.