Transcript: Mouse NM_027556.1

Mus musculus centrosomal protein 192 (Cep192), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Cep192 (70799)
Length:
8125
CDS:
256..7800

Additional Resources:

NCBI RefSeq record:
NM_027556.1
NBCI Gene record:
Cep192 (70799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000346179 GAGAACCTGTTGCGTTAATAA pLKO_005 2087 CDS 100% 15.000 21.000 N Cep192 n/a
2 TRCN0000346124 GCGACAGTTAATTACCATTTA pLKO_005 1897 CDS 100% 13.200 18.480 N Cep192 n/a
3 TRCN0000346180 GTGTAAATGACCTGCTTATAT pLKO_005 7815 3UTR 100% 15.000 12.000 N Cep192 n/a
4 TRCN0000346123 GGACACTCTCTGTAGTAATAA pLKO_005 2304 CDS 100% 15.000 10.500 N Cep192 n/a
5 TRCN0000346122 GTGTAGGTACTGTCGATAATA pLKO_005 1148 CDS 100% 15.000 10.500 N Cep192 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.