Transcript: Mouse NM_027597.4

Mus musculus family with sequence similarity 71, member D (Fam71d), transcript variant 2, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Fam71d (70897)
Length:
1744
CDS:
321..1502

Additional Resources:

NCBI RefSeq record:
NM_027597.4
NBCI Gene record:
Fam71d (70897)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027597.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182786 CGTAGGCATCTGTTCTTCCAA pLKO.1 530 CDS 100% 3.000 4.200 N Fam71d n/a
2 TRCN0000215862 CTCTAGAGAACAATCCTTTAT pLKO.1 1539 3UTR 100% 13.200 9.240 N Fam71d n/a
3 TRCN0000216393 GATCACAGATGTTCAAGATAT pLKO.1 1085 CDS 100% 13.200 9.240 N Fam71d n/a
4 TRCN0000423395 ACACACAGATACCCTTGTAAC pLKO_005 978 CDS 100% 10.800 7.560 N Fam71d n/a
5 TRCN0000215888 CAAAGAAATATGTGATGAAAC pLKO.1 1418 CDS 100% 10.800 7.560 N Fam71d n/a
6 TRCN0000217837 CTGTCACCATGTCAAACATAG pLKO.1 1327 CDS 100% 10.800 7.560 N Fam71d n/a
7 TRCN0000200116 CCTCCTATACTGGAGAGCAAT pLKO.1 447 CDS 100% 4.950 3.465 N Fam71d n/a
8 TRCN0000421196 TGCTAAGAACATGCGTCTCAA pLKO_005 716 CDS 100% 4.950 3.465 N Fam71d n/a
9 TRCN0000181506 GAATAAGCAAGAAGCCCTCTT pLKO.1 353 CDS 100% 4.050 2.835 N Fam71d n/a
10 TRCN0000177287 GCTTGGAAGATATTTGCACAA pLKO.1 1509 3UTR 100% 4.050 2.835 N Fam71d n/a
11 TRCN0000182273 GCATCTGTTCTTCCAATCCCA pLKO.1 535 CDS 100% 0.750 0.525 N Fam71d n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027597.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.