Transcript: Mouse NM_027609.2

Mus musculus spermatogenesis associated glutamate (E)-rich protein 4F1 (Speer4f1), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Speer4f1 (70935)
Length:
1232
CDS:
5..781

Additional Resources:

NCBI RefSeq record:
NM_027609.2
NBCI Gene record:
Speer4f1 (70935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027609.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421359 CCAAGATCATGAGGCTAAATC pLKO_005 285 CDS 100% 13.200 7.920 N Speer4f1 n/a
2 TRCN0000446923 CACTTGTCCTGAGTGGGAATA pLKO_005 901 3UTR 100% 10.800 6.480 N Speer4f1 n/a
3 TRCN0000201313 GCCCTAATGGAGAACAATCTT pLKO.1 446 CDS 100% 5.625 3.375 N Speer4f1 n/a
4 TRCN0000200894 CCACAATCTTCCTCAGATGAA pLKO.1 869 3UTR 100% 4.950 2.970 N Speer4f1 n/a
5 TRCN0000434795 AGCTCAAGAAGGAGATAAATT pLKO_005 402 CDS 100% 15.000 7.500 Y Speer4f1 n/a
6 TRCN0000249995 GAGCTCAAGAAGGAGATAAAT pLKO_005 401 CDS 100% 15.000 7.500 Y Speer4b n/a
7 TRCN0000176553 CCTCAGATGAATCTTCTTATA pLKO.1 879 3UTR 100% 13.200 6.600 Y 5031410I06Rik n/a
8 TRCN0000415178 TATGAAGAACTGAAGTTAAAG pLKO_005 311 CDS 100% 13.200 6.600 Y Speer4f1 n/a
9 TRCN0000439437 GACGTGAACCTGAGTGGTAAA pLKO_005 545 CDS 100% 10.800 5.400 Y Speer4f1 n/a
10 TRCN0000192202 CCTGTCACAAGCAATCAGTTT pLKO.1 173 CDS 100% 4.950 2.475 Y Speer4f1 n/a
11 TRCN0000190025 GCACTGCTATCAAGTGTCCAA pLKO.1 1009 3UTR 100% 2.640 1.320 Y Speer4f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027609.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.