Transcript: Mouse NM_027616.3

Mus musculus coiled coil domain containing 178 (Ccdc178), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ccdc178 (70950)
Length:
3335
CDS:
132..2732

Additional Resources:

NCBI RefSeq record:
NM_027616.3
NBCI Gene record:
Ccdc178 (70950)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027616.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265120 CTGAAAGAGCGTTACCATAAA pLKO_005 978 CDS 100% 13.200 18.480 N Ccdc178 n/a
2 TRCN0000265116 ACCTAGAAAGGACGAACTATG pLKO_005 2164 CDS 100% 10.800 15.120 N Ccdc178 n/a
3 TRCN0000265118 ACTCTAAGATGCTGCATAATA pLKO_005 1939 CDS 100% 15.000 12.000 N Ccdc178 n/a
4 TRCN0000265119 CGCTGTCAGGAACGATCTAAT pLKO_005 2927 3UTR 100% 13.200 10.560 N Ccdc178 n/a
5 TRCN0000201123 CACTCTAAGATGCTGCATAAT pLKO.1 1938 CDS 100% 13.200 9.240 N Ccdc178 n/a
6 TRCN0000201549 CCTGCGTTTAGCCAAAGAATA pLKO.1 2396 CDS 100% 13.200 9.240 N Ccdc178 n/a
7 TRCN0000265117 TACGAAGACAAGTACTCTATA pLKO_005 1837 CDS 100% 13.200 9.240 N Ccdc178 n/a
8 TRCN0000190863 GCAAGAATACTTCCGACTGAT pLKO.1 2552 CDS 100% 4.950 3.465 N Ccdc178 n/a
9 TRCN0000136236 GCCATTTCACACTTCCATGAA pLKO.1 2823 3UTR 100% 4.950 3.465 N CCDC178 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027616.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.