Transcript: Mouse NM_027677.2

Mus musculus G protein-coupled receptor 39 (Gpr39), mRNA.

Source:
NCBI, updated 2019-02-21
Taxon:
Mus musculus (mouse)
Gene:
Gpr39 (71111)
Length:
2690
CDS:
342..1712

Additional Resources:

NCBI RefSeq record:
NM_027677.2
NBCI Gene record:
Gpr39 (71111)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004639 CATCAGGGTTACGCAGGTATT pLKO.1 494 CDS 100% 10.800 15.120 N Gpr39 n/a
2 TRCN0000004642 GTATCGAGTACCCTCTGGTAA pLKO.1 865 CDS 100% 4.950 6.930 N Gpr39 n/a
3 TRCN0000004638 GTGGCTTTCATGTGTTGGAAT pLKO.1 1053 CDS 100% 4.950 3.465 N Gpr39 n/a
4 TRCN0000004641 CCAGCTATGCTCTGTCCTGTA pLKO.1 646 CDS 100% 4.050 2.835 N Gpr39 n/a
5 TRCN0000004640 GTATTGCAGAAGAAGGGCTAT pLKO.1 510 CDS 100% 4.050 2.835 N Gpr39 n/a
6 TRCN0000378613 GCATGCCCATGGAGTTCTACA pLKO_005 598 CDS 100% 4.950 2.970 N GPR39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.